Confirmed ARS at X-455

ARS1016

Status: Confirmed ARS: Confirmed by ARS assay and identified by 6 genome-wide studies.

Genomic Location: Chr10:454276-455248
Within divergent intergenic space between YJR009C and YJR010W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -165.1 ΔG° (kcal/mol) at location 454706.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 25.2 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-455 has unique ID: 347

Loading - Please wait...

ARS at X-455 has unique ID: 347

Studies that cloned this origin

Wyrick et al. (2001): Chr10:454276-455248


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr10:453135-455425

Shor et al. (2009): Chr10:453100-454600 (orc2-1/wt peak ratio: 1.05)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr10:451760 (Trep: 25.2 min.) (Confidence: 4)

Alvino et al. (2007): Chr10:453800 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:457000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr10:454276-455248 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-455 has unique ID: 347

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Eaton et al. (2010):      CAGTTTTTCATTTACTTATGGTTTATTGGTTTT   
ACS LOGO:   ACS_logo  

ARS at X-455 has unique ID: 347

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at X-455 has unique ID: 347

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-455 has unique ID: 347

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Wyrick et al. (2001): PubMed | Science


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at X-455 has unique ID: 347