Confirmed ARS at VIII-6

ARS131n

Other names: X-ARS, proARS801

Status: Confirmed ARS: Confirmed by ARS assay and identified by 6 genome-wide studies.

Genomic Location: Chr8:5158-6168
Resolution insufficient to assign intergenic space.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -159.5 ΔG° (kcal/mol) at location 6041.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VIII-6 has unique ID: 263

Loading - Please wait...

ARS at VIII-6 has unique ID: 263

Studies that cloned this origin

Study details not curated: Chr8:5158-6168


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr8:5470-6400

Xu et al. (2006): Chr8:4841-9659

Shor et al. (2009): Chr8:4900-6600 (orc2-1/wt peak ratio: 0.79)

Szilard et al. (2010): Chr8:5135-5145

Müller et al. (2010): Chr8:4775-7100 (orc1-bah-delta/wt peak ratio: 0.68)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr8:7000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VIII-6 has unique ID: 263

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TATTTTTATGTTTAGGTGATTTTAGTGGTGATTT  
  Eaton et al. (2010):      TATTTTTATGTTTAGGTGATTTTAGTGGTGATT   
ACS LOGO:   ACS_logo  

ARS at VIII-6 has unique ID: 263

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VIII-6 has unique ID: 263

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VIII-6 has unique ID: 263

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VIII-6 has unique ID: 263