Confirmed ARS at VII-654

ARS726

Other names: proARS726

Status: Confirmed ARS: Confirmed by ARS assay and identified by 6 genome-wide studies.

Genomic Location: Chr7:653611-654091
Within divergent intergenic space between YGR087C and YGR088W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -154.5 ΔG° (kcal/mol) at location 654091.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 25.9 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VII-654 has unique ID: 243

Loading - Please wait...

ARS at VII-654 has unique ID: 243

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr7:653611-654091


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr7:652975-653785

Xu et al. (2006): Chr7:652705-655045

Szilard et al. (2010): Chr7:653825-653835


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr7:659534 (Trep: 25.9 min.) (Confidence: 9)

Alvino et al. (2007): Chr7:659110 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr7:653682-654182 (Activity detected in: rad9, rev3 rad30, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-654 has unique ID: 243

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      CTTTTCTTTTATGTTTTGATAGACAAAGGTTTTT  
ACS LOGO:   ACS_logo  

ARS at VII-654 has unique ID: 243

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VII-654 has unique ID: 243

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VII-654 has unique ID: 243

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VII-654 has unique ID: 243