Confirmed ARS at I-7

ARS102.5

Other names: proARS103

Status: Confirmed ARS: Confirmed by ARS assay and identified by 6 genome-wide studies.

Genomic Location: Chr1:6136-7136
Within convergent intergenic space between YAL067W-A and YAL067C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -152.8 ΔG° (kcal/mol) at location 6391.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 27.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at I-7 has unique ID: 2

Loading - Please wait...

ARS at I-7 has unique ID: 2

Studies that cloned this origin

Xu et al. (2006): Chr1:6136-7136


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr1:7475-8538

Xu et al. (2006): Chr1:5841-11266

Szilard et al. (2010): Chr1:6505-6515

Müller et al. (2010): Chr1:6500-6875 (orc1-bah-delta/wt peak ratio: -0.08)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr1:14259 (Trep: 27.5 min.) (Confidence: 9)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr1:10000 (Activity detected in: wild-type, rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at I-7 has unique ID: 2

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      GATATTTATTTTTTGAACTACAATGTACTTTTAA  
ACS LOGO:   ACS_logo  

ARS at I-7 has unique ID: 2

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at I-7 has unique ID: 2

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at I-7 has unique ID: 2

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at I-7 has unique ID: 2