Confirmed ARS at VI-6

ARS600.1

Other names: ARS120; X-ARS, proARS600.1

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr6:5435-6155
Within divergent intergenic space between YFL064C and YFL062W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -154.1 ΔG° (kcal/mol) at location 6071.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-6 has unique ID: 195

Loading - Please wait...

ARS at VI-6 has unique ID: 195

Studies that cloned this origin

Eisenberg et al. (1988): Chr6:5435-6155


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr6:5113-5312

Xu et al. (2006): Chr6:4266-9005

Shor et al. (2009): Chr6:4800-6600 (orc2-1/wt peak ratio: 0.84)

Müller et al. (2010): Chr6:4700-6650 (orc1-bah-delta/wt peak ratio: 0.70)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:4333 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-6 has unique ID: 195

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TATTTTTATGTTTAGGTGATTTTAGTGGTGATTT  
  Eaton et al. (2010):      TATTTTTATGTTTAGGTGATTTTAGTGGTGATT   
ACS LOGO:   ACS_logo  

ARS at VI-6 has unique ID: 195

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-6 has unique ID: 195

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-6 has unique ID: 195

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Eisenberg et al. (1988): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VI-6 has unique ID: 195