Confirmed ARS at V-12

ARS504.2

Other names: proARS505

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr5:11713-12194
Within divergent intergenic space between YEL073C and YEL072W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -150.1 ΔG° (kcal/mol) at location 12183.

Time of Origin Replication (Trep): Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at V-12 has unique ID: 171

Loading - Please wait...

ARS at V-12 has unique ID: 171

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr5:11713-12194


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr5:11252-12485

Xu et al. (2006): Chr5:10427-12927

Shor et al. (2009): Chr5:11700-12500 (orc2-1/wt peak ratio: 0.03)

Szilard et al. (2010): Chr5:11865-11875

Müller et al. (2010): Chr5:11600-12800 (orc1-bah-delta/wt peak ratio: 0.24)


Studies that measured the replication time of this origin

Alvino et al. (2007): Chr5:12778 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr5:11507-12007 (Activity detected in: mrc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at V-12 has unique ID: 171

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      GCAATATATATTTAGTTCTAAAATGCGCTACTAA  
ACS LOGO:   ACS_logo  

ARS at V-12 has unique ID: 171

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at V-12 has unique ID: 171

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at V-12 has unique ID: 171

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at V-12 has unique ID: 171