Likely ARS at XVI-377

No systematic name assigned

Status: Likely ARS: Identified by 6 genome-wide studies.

Genomic Location: Chr16:376723-377937
Probably within convergent intergenic space between YPL091W and YPL090C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -156.3 ΔG° (kcal/mol) at location 377823.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 20.8 min.
Yabuki et al. (2002) — Trep: 23.7 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XVI-377 has unique ID: 767

Loading - Please wait...

ARS at XVI-377 has unique ID: 767

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr16:376725-377935

Shor et al. (2009): Chr16:377200-377900 (orc2-1/wt peak ratio: 0.76)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr16:384442 (Trep: 20.8 min.) (Confidence: 9)

Yabuki et al. (2002): Chr16:382633 (Trep: 23.7 min.)

Alvino et al. (2007): Chr16:384000 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr16:376723-377937 (Activity detected in: ctf4, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XVI-377 has unique ID: 767

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      ATTTTTCTTTTTGTTAATTATATAAAAAATAAAG  
ACS LOGO:   ACS_logo  

ARS at XVI-377 has unique ID: 767

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XVI-377 has unique ID: 767

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XVI-377 has unique ID: 767

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XVI-377 has unique ID: 767