Dubious ARS at XII-7

No systematic name assigned

Status: Dubious ARS: Identified by 6 genome-wide studies.

Genomic Location: Chr12:5107-7993
Resolution insufficient to assign intergenic space.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -168.4 ΔG° (kcal/mol) at location 6501.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 40.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XII-7 has unique ID: 721

Loading - Please wait...

ARS at XII-7 has unique ID: 721

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr12:5109-7991

Shor et al. (2009): Chr12:5700-8600 (orc2-1/wt peak ratio: 0.63)

Müller et al. (2010): Chr12:5600-6425 (orc1-bah-delta/wt peak ratio: 0.65)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr12:14756 (Trep: 40.0 min.) (Confidence: 1)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr12:9500

Feng et al. (2006): Chr12:3000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XII-7 has unique ID: 721

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTATTTTATGTTTACTTTTTATAGATTGTCTTTT  
  Eaton et al. (2010):      TTATTTTATGTTTACTTTTTATAGATTGTCTTT   
ACS LOGO:   ACS_logo  

ARS at XII-7 has unique ID: 721

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XII-7 has unique ID: 721

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XII-7 has unique ID: 721

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XII-7 has unique ID: 721