Confirmed ARS at X-609

ARS1018.5

Status: Confirmed ARS: Confirmed by ARS assay and identified by 6 genome-wide studies.

Genomic Location: Chr10:609000-609750
Within tandem intergenic space between YJR094W-A and YJR095W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -150.4 ΔG° (kcal/mol) at location 609430.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 19.1 min.
Yabuki et al. (2002) — Trep: 19.7 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-609 has unique ID: 712

Loading - Please wait...

ARS at X-609 has unique ID: 712

Studies that cloned this origin

Xu et al. (2006): Chr10:609000-609750


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr10:608675-610065


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr10:612264 (Trep: 19.1 min.) (Confidence: 9)

Yabuki et al. (2002): Chr10:612933 (Trep: 19.7 min.)

Alvino et al. (2007): Chr10:613220 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:611750 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr10:609000-609750 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-609 has unique ID: 712

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      AAGAAACCTTCTTTTTGATAAATGGTACGCCCAG  
ACS LOGO:   ACS_logo  

ARS at X-609 has unique ID: 712

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at X-609 has unique ID: 712

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-609 has unique ID: 712

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at X-609 has unique ID: 712