Likely ARS at XV-618

No systematic name assigned

Other names: proARS1518

Status: Likely ARS: Identified by 5 genome-wide studies.

Genomic Location: Chr15:616913-618427
Resolution insufficient to assign intergenic space.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -155.1 ΔG° (kcal/mol) at location 617633.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XV-618 has unique ID: 568

Loading - Please wait...

ARS at XV-618 has unique ID: 568

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr15:616669-617516

Xu et al. (2006): Chr15:616915-618425

Szilard et al. (2010): Chr15:617315-617325


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr15:618000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr15:617136-617636 (Activity detected in: ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XV-618 has unique ID: 568

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTATTTACTGTTTTCTTCAATTTATAACATTTGG  
ACS LOGO:   ACS_logo  

ARS at XV-618 has unique ID: 568

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XV-618 has unique ID: 568

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XV-618 has unique ID: 568

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XV-618 has unique ID: 568