Confirmed ARS at XIII-879

ARS1331.7

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr13:878619-879115
Within convergent intergenic space between YMR304W and YMR305C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -151.6 ΔG° (kcal/mol) at location 879089.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 25.9 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIII-879 has unique ID: 493

Loading - Please wait...

ARS at XIII-879 has unique ID: 493

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr13:878619-879115


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr13:877555-879905

Szilard et al. (2010): Chr13:878795-878805


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr13:882870 (Trep: 25.9 min.) (Confidence: 1)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr13:878000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr13:878478-878978 (Activity detected in: ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIII-879 has unique ID: 493

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTTTTATGTTTTTTTATGATAATCTCTCAGC  
ACS LOGO:   ACS_logo  

ARS at XIII-879 has unique ID: 493

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XIII-879 has unique ID: 493

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIII-879 has unique ID: 493

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XIII-879 has unique ID: 493