Confirmed ARS at XIII-773

ARS1328

Other names: proARS1328

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr13:772629-772878
Within tandem intergenic space between YMR250W and YMR251W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -152.1 ΔG° (kcal/mol) at location 772699.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIII-773 has unique ID: 487

Loading - Please wait...

ARS at XIII-773 has unique ID: 487

Studies that cloned this origin

Nieduszynski et al. (2006): Chr13:772629-772878


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr13:772557-772914

Xu et al. (2006): Chr13:771905-773595

Szilard et al. (2010): Chr13:772785-772795


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr13:772500 (Activity detected in: rad53)

Crabbé et al. (2010): Chr13:772629-772878 (Activity detected in: tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIII-773 has unique ID: 487

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTTACTATTACTT                   
ACS LOGO:   ACS_logo  

ARS at XIII-773 has unique ID: 487

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTTTTGTCTTTTTTTTTTTTTTTTTTTACTATTACTTTCTTTTTCAAGCTTTTAAGC
S. kudriavzevii--TTGTCTACCTTTTTTTATGACGGCATTTTCTCATTAGGTCTCAAGAAATTAAGG
S. mikataeACCTGTCTATTTTCCTTTATTATGGTGTTTTTACCCTTTTTTT-AGGCCCTTTATT
S. paradoxus--CTGTCTTTTTTTCTTTACTGC----CTTTTTCTTTCTTTTTCAGGCCTTTAAGC
*****::**:***::**:*:*::*:*:**:**:*:

ARS at XIII-773 has unique ID: 487

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIII-773 has unique ID: 487

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


ARS at XIII-773 has unique ID: 487