Confirmed ARS at X-744

ARS1025

Other names: proARS1025

Status: Confirmed ARS: Confirmed by ARS assay and identified by 6 genome-wide studies.

Genomic Location: Chr10:744102-744703
Within intergenic space between YJR161C and chromosome end.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -152.2 ΔG° (kcal/mol) at location 744242.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 35.9 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-744 has unique ID: 359

Loading - Please wait...

ARS at X-744 has unique ID: 359

Studies that cloned this origin

Wyrick et al. (2001): Chr10:744102-744703


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:743688-744600

Xu et al. (2006): Chr10:743975-745615

Shor et al. (2009): Chr10:743900-745600 (orc2-1/wt peak ratio: 0.83)

Müller et al. (2010): Chr10:743900-745550 (orc1-bah-delta/wt peak ratio: 0.77)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr10:738267 (Trep: 35.9 min.) (Confidence: 4)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:742000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-744 has unique ID: 359

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TATTTTTATGTTTAGG                   
ACS LOGO:   ACS_logo  

ARS at X-744 has unique ID: 359

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeATTATGGTTGAAGAATAGAATATTTTTATGTTTAGGTGATTTTAGTGGTGATTTTT
S. kudriavzeviiCTTCTTATTGATAATTAGTATATTTTTATGTTTGGGTAATTTTAGTGGTGATTATT
S. mikatae--------------------TATTTCTGTGTT-AGGTTATTTTGGTGGTGATTTTT
S. paradoxus-TTATGGT-GATATGTAGTATATTTTTATGTTTAGGTGATTTTAGTGGTGATTATT
::::::::::*****:*:****::********:***********

ARS at X-744 has unique ID: 359

These notes are manually curated. To submit notes for this replication origin site please contact us.

Thursday, 24th August 2006 - Anne Donaldson:

The fragment tested by Wyrick et al (2001) for origin activity overlaps the chromosome X-right X element. This origin may therefore correspond to the X ARS.

ARS at X-744 has unique ID: 359

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Wyrick et al. (2001): PubMed | Science


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


ARS at X-744 has unique ID: 359