Confirmed ARS at X-162

ARS1007.5

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 6 genome-wide studies.

Genomic Location: Chr10:161435-161860
Within tandem intergenic space between YJL133W and YJL132W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -153.2 ΔG° (kcal/mol) at location 161835.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 26.5 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-162 has unique ID: 334

Loading - Please wait...

ARS at X-162 has unique ID: 334

Studies that cloned this origin

Xu et al. (2006): Chr10:161435-161860


Studies that analyzed this origin by 2D gel

Feng et al. (2006): Chr10:159458-162730


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr10:160725-162685

Szilard et al. (2010): Chr10:161535-161545


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr10:160753 (Trep: 26.5 min.) (Confidence: 9)

Alvino et al. (2007): Chr10:162500 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:161333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr10:161435-161860 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-162 has unique ID: 334

Studies that confirmed an essential ACS element

  Xu et al. (2006):         ATCTATGTTTA                      

Studies that predicted an essential ACS element

  Xu et al. (2006):      ACTTCTATTGTAACAAAATTGCAAGCTGCTGGAG  
ACS LOGO:   ACS_logo  

ARS at X-162 has unique ID: 334

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at X-162 has unique ID: 334

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-162 has unique ID: 334

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.


Studies that confirmed an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at X-162 has unique ID: 334