Confirmed ARS at VII-1002

ARS735

Other names: proARS735

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr7:1002182-1002571
Within convergent intergenic space between YGR254W and YGR255C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -149.9 ΔG° (kcal/mol) at location 1002362.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 32.9 min.
Yabuki et al. (2002) — Trep: 28.0 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VII-1002 has unique ID: 257

Loading - Please wait...

ARS at VII-1002 has unique ID: 257

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr7:1002182-1002571


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr7:1002235-1002518

Xu et al. (2006): Chr7:1001000-1003050

Shor et al. (2009): Chr7:1001000-1002300 (orc2-1/wt peak ratio: 1.21)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr7:999680 (Trep: 32.9 min.) (Confidence: 7)

Yabuki et al. (2002): Chr7:1001647 (Trep: 28.0 min.)

Alvino et al. (2007): Chr7:999120 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr7:1000000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-1002 has unique ID: 257

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTCATTTTATGTTAAAACAATTTCAGGTTTAC  
ACS LOGO:   ACS_logo  

ARS at VII-1002 has unique ID: 257

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VII-1002 has unique ID: 257

These notes are manually curated. To submit notes for this replication origin site please contact us.

Friday, 4th December 2009 - Conrad Nieduszynski:

Status manually changed to 'Dubious'. Shor et al. (2009) report that there is no detectable ARS activity in this region.

ARS at VII-1002 has unique ID: 257

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VII-1002 has unique ID: 257