Confirmed ARS at V-443

ARS519

Other names: proARS519

Status: Confirmed ARS: Confirmed by ARS assay and identified by 7 genome-wide studies.

Genomic Location: Chr5:442412-442731
Within tandem intergenic space between YER137C and TI(AAU)E1.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -157.3 ΔG° (kcal/mol) at location 442412.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 22.2 min.
Yabuki et al. (2002) — Trep: 20.6 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at V-443 has unique ID: 187

Loading - Please wait...

ARS at V-443 has unique ID: 187

Studies that cloned this origin

Study details not curated: Chr5:442412-442731


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr5:442412-442731

Xu et al. (2006): Chr5:441895-444855


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr5:438423 (Trep: 22.2 min.) (Confidence: 9)

Yabuki et al. (2002): Chr5:444386

Yabuki et al. (2002): Chr5:438386 (Trep: 20.6 min.)

Alvino et al. (2007): Chr5:438670 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr5:438750 (Activity detected in: wild-type, rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at V-443 has unique ID: 187

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTTAACATTTTTTTGAACTAATTAACCGTCC  
ACS LOGO:   ACS_logo  

ARS at V-443 has unique ID: 187

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at V-443 has unique ID: 187

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at V-443 has unique ID: 187

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at V-443 has unique ID: 187