Confirmed ARS at XIV-250

ARS1413

Other names: proARS1413

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr14:250259-250506
Within divergent intergenic space between YNL211C and YNL210W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -141.0 ΔG° (kcal/mol) at location 250429.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 29.1 min.
Yabuki et al. (2002) — Trep: 29.0 min.
Alvino et al. (2007) — Peak first observed at 17.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIV-250 has unique ID: ARS1413

Loading - Please wait...

ARS at XIV-250 has unique ID: ARS1413

Studies that cloned this origin

Nieduszynski et al. (2006): Chr14:250259-250506


Studies that analyzed this origin by 2D gel

Friedman et al. (1996): Chr14:248811-251501

Aparicio et al. (2004): Chr14:247554-252796

Gibson et al. (2004): Chr14:247554-252796


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr14:250314-250930

Xu et al. (2006): Chr14:249305-251235

Shor et al. (2009): Chr14:250300-251000 (orc2-1/wt peak ratio: 0.22)

Szilard et al. (2010): Chr14:250395-250405

Müller et al. (2010): Chr14:250325-251075 (orc1-bah-delta/wt peak ratio: 0.23)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr14:250798 (Trep: 29.1 min.) (Confidence: 5)

Yabuki et al. (2002): Chr14:249469 (Trep: 29.0 min.)

Alvino et al. (2007): Chr14:251200 (Peak first observed at 17.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr14:249333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr14:250259-250506 (Activity detected in: mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIV-250 has unique ID: ARS1413

Studies that confirmed an essential ACS element

  Friedman et al. (1996):         ATTTGTATTTA                      

Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       AATTTTTACGGTTTTT                   
  Xu et al. (2006):      ACAATTTGTATTTAGTTGGTGTGACCTCAAATTT  
  Eaton et al. (2010):      ACAATTTGTATTTAGTTGGTGTGACCTCAAATT   
ACS LOGO:   ACS_logo  

ARS at XIV-250 has unique ID: ARS1413

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeATTTAGTTGGTGTGACCTCAAATTTTTACGGTTTTTTGAAAAGAACCCGTTATGAA
S. kudriavzeviiGTTTAGTTG--TTGATAGAATGTTTTTATGATCATTGAAAAAAAAAAGGTTTAGAA
S. mikataeGTTTAGTTGGGGCAACAAAAGATATATTTGTTCCTTCAAAAAGGGCGC----TTGA
S. paradoxusATATAGTTAATCTGACGTCTCATATTTTTGGTTCTGCAAAAAGTACCCGTTAGAGC
S. bayanusGTTTAGTTAGTGTAA-----------TTTGTATTTTAAGAAAATTTCGGATATGAA
*:*****:*::::*:*:*::::***:::

ARS at XIV-250 has unique ID: ARS1413

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIV-250 has unique ID: ARS1413

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Friedman et al. (1996): PubMed

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Gibson et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that confirmed an essential ACS element

Friedman et al. (1996): PubMed


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XIV-250 has unique ID: ARS1413