Confirmed ARS at XIV-196

ARS1412

Other names: proARS1412

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr14:196055-196291
Within convergent intergenic space between YNL242W and YNL241C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -147.6 ΔG° (kcal/mol) at location 196275.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 29.6 min.
Yabuki et al. (2002) — Trep: 30.1 min.
Alvino et al. (2007) — Peak first observed at 17.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIV-196 has unique ID: ARS1412

Loading - Please wait...

ARS at XIV-196 has unique ID: ARS1412

Studies that cloned this origin

Nieduszynski et al. (2006): Chr14:196055-196291


Studies that analyzed this origin by 2D gel

Friedman et al. (1996): Chr14:194901-197536


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr14:196101-196425

Xu et al. (2006): Chr14:195295-197295

Shor et al. (2009): Chr14:195500-197800 (orc2-1/wt peak ratio: 0.68)

Szilard et al. (2010): Chr14:196145-196155

Müller et al. (2010): Chr14:195725-196925 (orc1-bah-delta/wt peak ratio: 0.58)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr14:201788 (Trep: 29.6 min.) (Confidence: 9)

Yabuki et al. (2002): Chr14:198969 (Trep: 30.1 min.)

Alvino et al. (2007): Chr14:194500 (Peak first observed at 17.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr14:196000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr14:196055-196291 (Activity detected in: tof1, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIV-196 has unique ID: ARS1412

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTAACTTTTAGCC                   
  Xu et al. (2006):      TTTTTTAACTTTTAGCCGCGGTCAGTGACATTTT  
  Eaton et al. (2010):      TTTTTTAACTTTTAGCCGCGGTCAGTGACATTT   
ACS LOGO:   ACS_logo  

ARS at XIV-196 has unique ID: ARS1412

Alignments from the UCSC genome browser

Predicted ACS
*

ARS at XIV-196 has unique ID: ARS1412

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIV-196 has unique ID: ARS1412

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Friedman et al. (1996): PubMed


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XIV-196 has unique ID: ARS1412