Confirmed ARS at III-316

ARS319

Other names: X-ARS

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 3 genome-wide studies.

Genomic Location: Chr3:315346-316232
Resolution insufficient to assign intergenic space.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -156.0 ΔG° (kcal/mol) at location 315936.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity not detected in HU.

ARS at III-316 has unique ID: 90

Loading - Please wait...

ARS at III-316 has unique ID: 90

Studies that cloned this origin

Poloumienko et al. (2001): Chr3:315346-316232


Studies that analyzed this origin by 2D gel

Aparicio et al. (2004): Chr3:313858-316613


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr3:314550-316545

Shor et al. (2009): Chr3:314500-316500 (orc2-1/wt peak ratio: 0.87)

Müller et al. (2010): Chr3:314975-316475 (orc1-bah-delta/wt peak ratio: 0.72)


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-316 has unique ID: 90

Studies that confirmed an essential ACS element

  Chang et al. (2008):         TTTTATGTTTAG                     

Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       ATTTTTATGTTTAGG                    
  Xu et al. (2006):      TTTTATGTTTAGGTGATTTTAGTGGTGATTTTTC  
  Eaton et al. (2010):      TATTTTTATGTTTAGGTGATTTTAGTGGTGATT   
ACS LOGO:   ACS_logo  

ARS at III-316 has unique ID: 90

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTTATGGTTGAAGAATAGAATATTTTTATGTTTAGGTGATTTTAGTGGTGATTTTT
S. kudriavzeviiTTCTTATTGATAATTAGTATATTTTTATGTTTGGGTAATTTTAGTGGTGATTATT
S. mikatae-------------------TATTTCTGTGTT-AGGTTATTTTGGTGGTGATTTTT
S. paradoxusTTATGGT-GATATGTAGTATATTTTTATGTTTAGGTGATTTTAGTGGTGATTATT
::::::::::*****:*:****::********:***********

ARS at III-316 has unique ID: 90

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-316 has unique ID: 90

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Poloumienko et al. (2001): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that confirmed an essential ACS element

Chang et al. (2008): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at III-316 has unique ID: 90