Likely ARS at XVI-930

No systematic name assigned

Status: Likely ARS: Identified by 4 genome-wide studies.

Genomic Location: Chr16:929725-930435
Probably within divergent intergenic space between YPR194C and YPR196W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -150.0 ΔG° (kcal/mol) at location 930285.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 22.1 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XVI-930 has unique ID: 821

Loading - Please wait...

ARS at XVI-930 has unique ID: 821

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr16:929505-933985

Szilard et al. (2010): Chr16:930075-930085


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr16:934218 (Trep: 22.1 min.) (Confidence: 9)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr16:932333 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XVI-930 has unique ID: 821

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      ATTATTTGTTTTGTAAGAACCATTGCAGATAACT  
ACS LOGO:   ACS_logo  

ARS at XVI-930 has unique ID: 821

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XVI-930 has unique ID: 821

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XVI-930 has unique ID: 821

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XVI-930 has unique ID: 821