Confirmed ARS at V-278

ARS513.7

Status: Confirmed ARS: Confirmed by ARS assay and identified by 6 genome-wide studies.

Genomic Location: Chr5:278073-278355
Within convergent intergenic space between YER060W-A and YER061C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -149.4 ΔG° (kcal/mol) at location 278323.

Time of Origin Replication (Trep): Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at V-278 has unique ID: 779

Loading - Please wait...

ARS at V-278 has unique ID: 779

Studies that cloned this origin

Shor et al. (2009): Chr5:278073-278355


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr5:275575-278875

Shor et al. (2009): Chr5:277600-278900 (orc2-1/wt peak ratio: 0.30)

Szilard et al. (2010): Chr5:277995-278005

Müller et al. (2010): Chr5:277475-278825 (orc1-bah-delta/wt peak ratio: 0.55)


Studies that measured the replication time of this origin

Alvino et al. (2007): Chr5:285120 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr5:276666 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at V-278 has unique ID: 779

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TCAATTAACATTTAGTCATCGACCGAAATATTTG  
ACS LOGO:   ACS_logo  

ARS at V-278 has unique ID: 779

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at V-278 has unique ID: 779

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at V-278 has unique ID: 779

Genome-wide studies that identified this origin

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at V-278 has unique ID: 779