Dubious ARS at III-146

No systematic name assigned

Status: Dubious ARS: Identified by 5 genome-wide studies.

Genomic Location: Chr3:138948-153948
Resolution insufficient to assign intergenic space.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -168.0 ΔG° (kcal/mol) at location 149888.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 23.3 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at III-146 has unique ID: 76

Loading - Please wait...

ARS at III-146 has unique ID: 76

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Shor et al. (2009): Chr3:137800-139400 (orc2-1/wt peak ratio: 0.96)

Müller et al. (2010): Chr3:149825-151475 (orc1-bah-delta/wt peak ratio: 0.26)

Müller et al. (2010): Chr3:148700-149750


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:146448 (Trep: 23.3 min.) (Confidence: 8)

Alvino et al. (2007): Chr3:133710 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-146 has unique ID: 76

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTATTTTTTGAATATTTTTTATTTATATACGT  
ACS LOGO:   ACS_logo  

ARS at III-146 has unique ID: 76

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at III-146 has unique ID: 76

These notes are manually curated. To submit notes for this replication origin site please contact us.

Friday, 18th August 2006 - Conrad Nieduszynski:

Carol Newlon's lab report that there is no detectable ARS activity in this region. [Thanks to Carol Newlon for this information.]

ARS at III-146 has unique ID: 76

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at III-146 has unique ID: 76