Likely ARS at IX-226

No systematic name assigned

Status: Likely ARS: Identified by 3 genome-wide studies.

Genomic Location: Chr9:224943-227297
Probably within divergent intergenic space between YIL073C and YIL072W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -155.3 ΔG° (kcal/mol) at location 227283.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 22.1 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IX-226 has unique ID: 706

Loading - Please wait...

ARS at IX-226 has unique ID: 706

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr9:224945-227295


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr9:220091 (Trep: 22.1 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr9:225850-226350 (Activity detected in: rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IX-226 has unique ID: 706

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      ATGTTTTGCATTTTGTTATATACCGCATAACTCG  
ACS LOGO:   ACS_logo  

ARS at IX-226 has unique ID: 706

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at IX-226 has unique ID: 706

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IX-226 has unique ID: 706

Genome-wide studies that identified this origin

Yabuki et al. (2002): PubMed

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at IX-226 has unique ID: 706