Confirmed ARS at II-708

ARS222.5

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr2:707158-708262
Resolution insufficient to assign intergenic space.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -154.4 ΔG° (kcal/mol) at location 707508.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 34.9 min.
Yabuki et al. (2002) — Trep: 29.4 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at II-708 has unique ID: 662

Loading - Please wait...

ARS at II-708 has unique ID: 662

Studies that cloned this origin

Xu et al. (2006): Chr2:707158-708262


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr2:707150-708455


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr2:712538 (Trep: 34.9 min.) (Confidence: 9)

Yabuki et al. (2002): Chr2:706978 (Trep: 29.4 min.)

Alvino et al. (2007): Chr2:707000 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr2:704000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at II-708 has unique ID: 662

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      GTCCTTGCATTCTAAATCATAAAAAGATGTGGTC  
ACS LOGO:   ACS_logo  

ARS at II-708 has unique ID: 662

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at II-708 has unique ID: 662

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at II-708 has unique ID: 662

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at II-708 has unique ID: 662