Likely ARS at XII-1043

No systematic name assigned

Status: Likely ARS: Identified by 3 genome-wide studies.

Genomic Location: Chr12:1042798-1043952
Probably within divergent intergenic space between YLR453C and YLR454W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -148.6 ΔG° (kcal/mol) at location 1043158.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 35.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XII-1043 has unique ID: 648

Loading - Please wait...

ARS at XII-1043 has unique ID: 648

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr12:1042800-1043950


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr12:1049220 (Trep: 35.5 min.) (Confidence: 9)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr12:1042798-1043952 (Activity detected in: ctf8, ctf18, mrc1, dcc1, rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XII-1043 has unique ID: 648

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTAATTTTATGTTTTTCTTGAGGATCTTCCATAA  
  Xu et al. (2006):      TATTATTTTAGTTTTCTAATTTTGCAGCTGTTTT  
ACS LOGO:   ACS_logo  

ARS at XII-1043 has unique ID: 648

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XII-1043 has unique ID: 648

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XII-1043 has unique ID: 648

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XII-1043 has unique ID: 648