Likely ARS at XVI-19

No systematic name assigned

Other names: proARS1603

Status: Likely ARS: Identified by 3 genome-wide studies.

Genomic Location: Chr16:18202-19681
Probably within divergent intergenic space between YPL277C and YPL274W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -160.7 ΔG° (kcal/mol) at location 18222.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 29.9 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at XVI-19 has unique ID: 590

Loading - Please wait...

ARS at XVI-19 has unique ID: 590

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr16:18370-19069

Xu et al. (2006): Chr16:18204-19679


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr16:13256 (Trep: 29.9 min.) (Confidence: 8)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XVI-19 has unique ID: 590

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTGTTCTTGTTTTGGCGTATTCTCCACTATTCG  
ACS LOGO:   ACS_logo  

ARS at XVI-19 has unique ID: 590

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XVI-19 has unique ID: 590

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XVI-19 has unique ID: 590

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XVI-19 has unique ID: 590