Confirmed ARS at XV-155

ARS1509.5

Status: Confirmed ARS: Confirmed by ARS assay and identified by 2 genome-wide studies.

Genomic Location: Chr15:154972-155462
Within tandem intergenic space between YOL088C and YOL087C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -147.9 ΔG° (kcal/mol) at location 155412.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XV-155 has unique ID: 550

Loading - Please wait...

ARS at XV-155 has unique ID: 550

Studies that cloned this origin

Breier et al. (2004): Chr15:154972-155462


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr15:154325-156090


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr15:154972-155462 (Activity detected in: ctf4, ddc1, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XV-155 has unique ID: 550

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTAAATTATATTTTGGGGTCTGAATTTGGAGTTT  
ACS LOGO:   ACS_logo  

ARS at XV-155 has unique ID: 550

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XV-155 has unique ID: 550

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XV-155 has unique ID: 550

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Breier et al. (2004): PubMed | PubMed Central | Genome Biol.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XV-155 has unique ID: 550