Confirmed ARS at II-517

ARS217

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr2:516805-517805
Within convergent intergenic space between YBR139W and YBR140C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -157.7 ΔG° (kcal/mol) at location 517025.

Time of Origin Replication (Trep): Alvino et al. (2007) — Peak first observed at 17.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at II-517 has unique ID: 46

Loading - Please wait...

ARS at II-517 has unique ID: 46

Studies that cloned this origin

Xu et al. (2006): Chr2:516805-517805


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr2:516245-518085

Szilard et al. (2010): Chr2:517205-517215


Studies that measured the replication time of this origin

Alvino et al. (2007): Chr2:515000 (Peak first observed at 17.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr2:517333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr2:516805-517805 (Activity detected in: ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at II-517 has unique ID: 46

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TTAAATTAGAGTATTGCAGTGATTATATACGTTT  
ACS LOGO:   ACS_logo  

ARS at II-517 has unique ID: 46

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at II-517 has unique ID: 46

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at II-517 has unique ID: 46

Genome-wide studies that identified this origin

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at II-517 has unique ID: 46