Confirmed ARS at XI-196

ARS1106.3

Other names: ARS1126

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr11:196038-196284
Within tandem intergenic space between YKL130C and YKL129C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -142.3 ΔG° (kcal/mol) at location 196088.

Time of Origin Replication (Trep): Alvino et al. (2007) — Peak first observed at 17.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XI-196 has unique ID: 372

Loading - Please wait...

ARS at XI-196 has unique ID: 372

Studies that cloned this origin

Nieduszynski et al. (2006): Chr11:196038-196284


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr11:195955-196855

Szilard et al. (2010): Chr11:196135-196145


Studies that measured the replication time of this origin

Alvino et al. (2007): Chr11:192000 (Peak first observed at 17.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr11:196500 (Activity detected in: rad53)

Crabbé et al. (2010): Chr11:196038-196284 (Activity detected in: pol2-12, elg1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XI-196 has unique ID: 372

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTCATTTTTTGTT                   
  Xu et al. (2006):      TTTTTTTTTTCATTTTTTGTTTGTATTTTCCCGT  
ACS LOGO:   ACS_logo  

ARS at XI-196 has unique ID: 372

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeAAAGTCCCTTTTTTTTTTTTTTTTTCATTTTTTGTTTGTATTTTCCCGTTTTGAAA
S. kudriavzeviiTATATCCT-TTCTCTCTTTGTTTTTCATTTTTTGTTTATGTTTT-CCCGTTTGAAA
S. mikataeAGAGACTC-TCTTCTCTTTGTTTTTCATTTCTTGTCTATATCTT-CCGGTTTGAAA
S. paradoxusGAAGGCCC-TTTTCTCTTTGTTTTTCGTTTTTTGTTTGTAACTT-CCCGTTTGAAA
S. bayanus------TT-TTCCCTTTCTTTTTTTCAATTTTTGTTTACGTCTT-CCCGTTTGAAA
::*:::**:*******::**:****:*::**:**:*******

ARS at XI-196 has unique ID: 372

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XI-196 has unique ID: 372

Genome-wide studies that identified this origin

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XI-196 has unique ID: 372