Confirmed ARS at X-730

ARS1023

Other names: proARS1023

Status: Confirmed ARS: Confirmed by ARS assay and identified by 4 genome-wide studies.

Genomic Location: Chr10:729677-730208
Within divergent intergenic space between YJR156C and YJR158W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -146.6 ΔG° (kcal/mol) at location 730127.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 31.7 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-730 has unique ID: 356

Loading - Please wait...

ARS at X-730 has unique ID: 356

Studies that cloned this origin

Wyrick et al. (2001): Chr10:729677-730208


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:729285-730204

Xu et al. (2006): Chr10:728515-731275


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr10:732933 (Trep: 31.7 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:729000 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-730 has unique ID: 356

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       ATTTTTTACGTTTTCT                   
  Xu et al. (2006):      AAAGTTTATAAGTCGTTACATATTTTTCTATGGT  
  Xu et al. (2006):      GATGTACCAGAACATCCAGGAACTTACCATAGAA  
ACS LOGO:   ACS_logo  

ARS at X-730 has unique ID: 356

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeATTTCGATTATAACTCTAACATTTTTTACGTTTTCTCCATATTTCGAATTGTTCCT
S. paradoxusATTTTGATCCTAAATATAACATTTTTTAATTTTTGTACATAGTTGTATATGTTCTT
****:***::***:*:************::****:*:****:**::*::*****:*

ARS at X-730 has unique ID: 356

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-730 has unique ID: 356

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that cloned this origin

Wyrick et al. (2001): PubMed | Science


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at X-730 has unique ID: 356