Confirmed ARS at X-16

ARS1003

Other names: proARS1003

Status: Confirmed ARS: Confirmed by ARS assay and identified by 4 genome-wide studies.

Genomic Location: Chr10:16123-16762
Within convergent intergenic space between YJL222W and YJL221C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -146.4 ΔG° (kcal/mol) at location 16303.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at X-16 has unique ID: 328

Loading - Please wait...

ARS at X-16 has unique ID: 328

Studies that cloned this origin

Wyrick et al. (2001): Chr10:16123-16762


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr10:16124-16767

Xu et al. (2006): Chr10:15779-19046

Szilard et al. (2010): Chr10:16715-16725


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr10:15500 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at X-16 has unique ID: 328

Studies that confirmed an essential ACS element

  Xu et al. (2006):         TTTTATTTTTAT                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTTTATTTTTATGTATGAGAACTGCCGAAAA  
ACS LOGO:   ACS_logo  

ARS at X-16 has unique ID: 328

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at X-16 has unique ID: 328

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at X-16 has unique ID: 328

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Wyrick et al. (2001): PubMed | Science


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at X-16 has unique ID: 328