Confirmed ARS at VI-217

ARS608

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 4 genome-wide studies.

Genomic Location: Chr6:216344-216692
Within convergent intergenic space between YFR030W and YFR031C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -145.9 ΔG° (kcal/mol) at location 216594.

Time of Origin Replication (Trep): This site was not identified as an origin by any curated timing study (Raghuraman et al. (2001); Yabuki et al. (2002); Alvino et al. (2007)), suggesting that this site is not chromosomally active for replication initiation.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VI-217 has unique ID: 209

Loading - Please wait...

ARS at VI-217 has unique ID: 209

Studies that cloned this origin

Shirahige et al. (1993): Chr6:216344-216692


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): Chr6:211554-220142


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr6:215695-217255

Szilard et al. (2010): Chr6:216545-216555


Studies that measured the replication time of this origin

The replication time of origin has not be reported by any curated study.


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr6:216333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr6:216344-216692 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VI-217 has unique ID: 209

Studies that confirmed an essential ACS element

  Shirahige et al. (1993):         TTTTACTTTTAG                     

Studies that predicted an essential ACS element

  Xu et al. (2006):      TTTTTTTACTTTTAGTTTTCTTCTATGCGCAAGC  
ACS LOGO:   ACS_logo  

ARS at VI-217 has unique ID: 209

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at VI-217 has unique ID: 209

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VI-217 has unique ID: 209

Genome-wide studies that identified this origin

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Shirahige et al. (1993): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

Yamashita et al. (1997): PubMed


Studies that confirmed an essential ACS element

Shirahige et al. (1993): PubMed | PubMed Central


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VI-217 has unique ID: 209