Confirmed ARS at V-302

ARS514.5

Status: Confirmed ARS: Confirmed by ARS assay and identified by 3 genome-wide studies.

Genomic Location: Chr5:301565-302061
Within convergent intergenic space between YER070W and YER071C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -154.6 ΔG° (kcal/mol) at location 301825.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 26.2 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at V-302 has unique ID: 182

Loading - Please wait...

ARS at V-302 has unique ID: 182

Studies that cloned this origin

Müller & Nieduszynski (2012): Chr5:301565-302061


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr5:301215-302385


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr5:295366 (Trep: 26.2 min.) (Confidence: 6)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr5:301213-302387 (Activity detected in: wild-type, rev3 rad30, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at V-302 has unique ID: 182

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      ATTATTTTTGTCTTCTAGTTTATAGTTGAATATA  
  Xu et al. (2006):      GTAATTTATATTTTCTTTTGTTTTCTCTGATAAA  
  Xu et al. (2006):      CCTATATATGTTTACTAATTATTTTTCTACTTTG  
ACS LOGO:   ACS_logo  

ARS at V-302 has unique ID: 182

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at V-302 has unique ID: 182

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at V-302 has unique ID: 182

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Müller & Nieduszynski (2012): PubMed | Genome Res.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at V-302 has unique ID: 182