Confirmed ARS at I-223

ARS112

Status: Confirmed ARS: Confirmed by ARS assay and identified by 3 genome-wide studies.

Genomic Location: Chr1:222871-224037
Within tandem intergenic space between YAR068W and YAR071W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -159.9 ΔG° (kcal/mol) at location 223781.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 29.9 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at I-223 has unique ID: 18

Loading - Please wait...

ARS at I-223 has unique ID: 18

Studies that cloned this origin

Xu et al. (2006): Chr1:222871-224037


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr1:223605-224675

Szilard et al. (2010): Chr1:224185-224195


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr1:226269 (Trep: 29.9 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at I-223 has unique ID: 18

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      TAAATCTACGTTTAGTATAAGAAAATTGTATTGT  
ACS LOGO:   ACS_logo  

ARS at I-223 has unique ID: 18

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at I-223 has unique ID: 18

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at I-223 has unique ID: 18

Genome-wide studies that identified this origin

Yabuki et al. (2002): PubMed

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at I-223 has unique ID: 18