Confirmed ARS at I-215

ARS111

Other names: proARS111

Status: Confirmed ARS: Confirmed by ARS assay and identified by 5 genome-wide studies.

Genomic Location: Chr1:214879-215635
Within tandem intergenic space between YAR050W and YAR064W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -148.8 ΔG° (kcal/mol) at location 215579.

Time of Origin Replication (Trep): Alvino et al. (2007) — Peak first observed at 17.5 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at I-215 has unique ID: 17

Loading - Please wait...

ARS at I-215 has unique ID: 17

Studies that cloned this origin

Xu et al. (2006): Chr1:214879-215635


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr1:214197-215673

Xu et al. (2006): Chr1:214145-216905

Shor et al. (2009): Chr1:214400-215900 (orc2-1/wt peak ratio: 0.31)

Müller et al. (2010): Chr1:214100-215900 (orc1-bah-delta/wt peak ratio: 0.72)


Studies that measured the replication time of this origin

Alvino et al. (2007): Chr1:213200 (Peak first observed at 17.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at I-215 has unique ID: 17

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      CTAATTTTTATTTTGAAATTGATATTATTCTTTA  
  Xu et al. (2006):      CATTTTAATATTTAGTTGGGAATGCAGCCATATT  
ACS LOGO:   ACS_logo  

ARS at I-215 has unique ID: 17

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at I-215 has unique ID: 17

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at I-215 has unique ID: 17

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at I-215 has unique ID: 17