Confirmed ARS at VII-978

ARS733

Other names: proARS733

Status: Confirmed ARS: Confirmed by ARS assay and identified by 11 genome-wide studies.

Genomic Location: Chr7:977730-977979
Within convergent intergenic space between YGR243W and YGR244C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -143.5 ΔG° (kcal/mol) at location 977730.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 34.0 min.
Yabuki et al. (2002) — Trep: 27.0 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VII-978 has unique ID: ARS733

Loading - Please wait...

ARS at VII-978 has unique ID: ARS733

Studies that cloned this origin

Nieduszynski et al. (2006): Chr7:977730-977979


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr7:977771-978031

Xu et al. (2006): Chr7:977205-978745

Shor et al. (2009): Chr7:977400-978300 (orc2-1/wt peak ratio: 0.36)

Szilard et al. (2010): Chr7:977865-977875

Müller et al. (2010): Chr7:977600-978200 (orc1-bah-delta/wt peak ratio: 0.29)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr7:982673

Raghuraman et al. (2001): Chr7:971168 (Trep: 34.0 min.) (Confidence: 2)

Yabuki et al. (2002): Chr7:979647 (Trep: 27.0 min.)

Alvino et al. (2007): Chr7:978330 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr7:978333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr7:977730-977979 (Activity detected in: ddc1, rad24, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-978 has unique ID: ARS733

Studies that confirmed an essential ACS element

  Nieduszynski et al. (2006):       TTTTTTTAATTTTTTT                   

Studies that predicted an essential ACS element

  Xu et al. (2006):      AATTTTTTTATATTTTTCCATCTTTTGATGTAAT  
ACS LOGO:   ACS_logo  

ARS at VII-978 has unique ID: ARS733

Alignments from the UCSC genome browser

Confirmed ACS
S. cerevisiaeTGGAAAAAATTTCTTTTTTTTTTTTTTAATTTTTTTATATTTTTCCATCTTTTGAT
S. kudriavzeviiTCAGAAGTATTTC---TTATTCTTGAT--TTTCTTTATAATTTT--ACCTTTTGTT
S. mikataeTACAGAAAAATTC---TTAATCTCGATGATTTTTACATTTCTTCACAT-TTTTGAT
S. paradoxusTAGAAAAAAATTC---TTATTCTTGAT--TTTTTTTATATTTTTTCACCTTTTGAT
S. bayanusAAAAAAAGATTTC---TTATTCTTTTC--TGTTTTTACTTTTTTTTACATTTAGAT
::::*:****:::**::*:*:::*:*:*::*:::**::****:*:*

ARS at VII-978 has unique ID: ARS733

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VII-978 has unique ID: ARS733

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VII-978 has unique ID: ARS733