Confirmed ARS at VII-575

ARS722

Other names: proARS722

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr7:574622-574916
Within divergent intergenic space between TS(AGA)G and YGR040W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -144.5 ΔG° (kcal/mol) at location 574912.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 29.2 min.
Yabuki et al. (2002) — Trep: 21.1 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at VII-575 has unique ID: ARS722

Loading - Please wait...

ARS at VII-575 has unique ID: ARS722

Studies that cloned this origin

Nieduszynski et al. (2006): Chr7:574622-574916


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr7:575193-575392

Xu et al. (2006): Chr7:574315-577745

Shor et al. (2009): Chr7:574600-575300 (orc2-1/wt peak ratio: 0.25)

Szilard et al. (2010): Chr7:575125-575135

Müller et al. (2010): Chr7:574625-575375 (orc1-bah-delta/wt peak ratio: 0.90)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr7:578499 (Trep: 29.2 min.) (Confidence: 3)

Yabuki et al. (2002): Chr7:570897 (Trep: 21.1 min.)

Alvino et al. (2007): Chr7:575250 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr7:576750 (Activity detected in: wild-type, rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-575 has unique ID: ARS722

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       GTATTTATGTTTTGTC                   
  Xu et al. (2006):      ATTTATGTTTTGTCATTCTTTTCTACATAATCTT  
  Eaton et al. (2010):      AGTATTTATGTTTTGTCATTCTTTTCTACATAA   
ACS LOGO:   ACS_logo  

ARS at VII-575 has unique ID: ARS722

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTTTTACCGGCTTAGTAATAC
S. kudriavzeviiTTCGACCGGTTTCGTGATAC
S. mikataeTTATACCAGTTTTGTACTAC
S. paradoxusTTTTTCCGGTATAGTAATAC
S. bayanusTTCTAGCAGTTTTATGATAC
**:::**::*:*:***

ARS at VII-575 has unique ID: ARS722

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VII-575 has unique ID: ARS722

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at VII-575 has unique ID: ARS722