Confirmed ARS at V-550

ARS522

Other names: ARS501, proARS522

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 9 genome-wide studies.

Genomic Location: Chr5:549560-549809
Within convergent intergenic space between YER179W and YER180C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -153.0 ΔG° (kcal/mol) at location 549770.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 32.5 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at V-550 has unique ID: ARS522

Loading - Please wait...

ARS at V-550 has unique ID: ARS522

Studies that cloned this origin

Nieduszynski et al. (2006): Chr5:549560-549809


Studies that analyzed this origin by 2D gel

Ferguson et al. (1991): Chr5:547713-550914


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr5:549513-549720

Xu et al. (2006): Chr5:548935-550395

Shor et al. (2009): Chr5:549200-550200 (orc2-1/wt peak ratio: 0.51)

Szilard et al. (2010): Chr5:549585-549595

Müller et al. (2010): Chr5:549050-549950 (orc1-bah-delta/wt peak ratio: 0.28)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr5:542464 (Trep: 32.5 min.) (Confidence: 8)

Alvino et al. (2007): Chr5:548330 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr5:549333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr5:549560-549809 (Activity detected in: tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at V-550 has unique ID: ARS522

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       ATTATTAATATCTTGT                   
  Xu et al. (2006):      TAATTTAATATTTTTTTTCCGAATTACAACAATT  
  Xu et al. (2006):      ATTATTAATATCTTGTTATGATTCTTTGTTTTAG  
  Eaton et al. (2010):      TAATTTAATATTTTTTTTCCGAATTACAACAAT   
ACS LOGO:   ACS_logo  

ARS at V-550 has unique ID: ARS522

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTTTTACTTTGTGTTACTAATATTATTAATATCTTGTTATGATTCTTTGTTTTAGCA
S. kudriavzeviiTCTTATTTAATT-----------ATTAATGTTTTTGCATGATTCTATGTTCAA-TG
S. mikataeATTGGTTTTGGA-----------ATTAATGTTTTTATATGCTTTTTTGTTTTA-CA
S. paradoxusTTTTACTTTGTG---------TTATTAATGTTTTCGTATGATTATCCGTTTAT-GA
S. bayanusCTTAACTTTGTA---------TTATTAATGTTTTGGAAAGGTTTTTCG--------
:*:**::::::::::::******:*:**:*:*****:::

ARS at V-550 has unique ID: ARS522

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at V-550 has unique ID: ARS522

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Ferguson et al. (1991): PubMed


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at V-550 has unique ID: ARS522