Confirmed ARS at IV-922

ARS429

Other names: proARS429

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr4:921682-921930
Within convergent intergenic space between YDR227W and YDR228C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -146.0 ΔG° (kcal/mol) at location 921922.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 12.0 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-922 has unique ID: ARS429

Loading - Please wait...

ARS at IV-922 has unique ID: ARS429

Studies that cloned this origin

Nieduszynski et al. (2006): Chr4:921682-921930


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:921683-921962

Xu et al. (2006): Chr4:920775-922925

Shor et al. (2009): Chr4:921300-922300 (orc2-1/wt peak ratio: 0.21)

Szilard et al. (2010): Chr4:921785-921795

Müller et al. (2010): Chr4:921275-922175 (orc1-bah-delta/wt peak ratio: 0.83)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr4:916986 (Trep: 12.0 min.) (Confidence: 9)

Alvino et al. (2007): Chr4:914890 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr4:921682-921930 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-922 has unique ID: ARS429

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       GATTTTAATGATTAGT                   
  Xu et al. (2006):      TCATTTGTTTATTTTTTTTTTTTTTTTTTTTGCT  
  Eaton et al. (2010):      GATTTTAATGATTAGTTGGGCTTTTGGCTACAT   
ACS LOGO:   ACS_logo  

ARS at IV-922 has unique ID: ARS429

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTTACTTTACGGTCTTTAATCGATTTTAATGATTAGTTGGGCTTTTGGCTACATATG
S. kudriavzeviiTTGCTTCAGGACTTTTTGCCGATTGTAATATTTAA-TGGG-TTTTGGCTACATTTG
S. mikataeTTACTTTATAGGCTTTCGCCGATTTTAATTATTAGTTAGG-TTTTGGTAACCTATG
S. paradoxus----------------------TTTTAATGATTGGTTTGG-CTTTGGCAACATATG
S. bayanusTCA----AGGCTTCTTTGCCGATTGTAATATTTAATTAGG-TTTTGGCTAAACATG
:::::::::::********::***::*****:*::::**

ARS at IV-922 has unique ID: ARS429

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-922 has unique ID: ARS429

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at IV-922 has unique ID: ARS429