Confirmed ARS at IV-254

ARS410

Other names: proARS410

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr4:253789-254038
Within convergent intergenic space between YDL116W and YDL115C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -146.1 ΔG° (kcal/mol) at location 253979.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 28.6 min.
Alvino et al. (2007) — Peak first observed at 17.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-254 has unique ID: ARS410

Loading - Please wait...

ARS at IV-254 has unique ID: ARS410

Studies that cloned this origin

Nieduszynski et al. (2006): Chr4:253789-254038


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:253745-253994

Xu et al. (2006): Chr4:252985-254870

Shor et al. (2009): Chr4:252900-254400 (orc2-1/wt peak ratio: 0.75)

Szilard et al. (2010): Chr4:253835-253845

Müller et al. (2010): Chr4:253175-254450 (orc1-bah-delta/wt peak ratio: 0.91)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr4:253291 (Trep: 28.6 min.)

Alvino et al. (2007): Chr4:252430 (Peak first observed at 17.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:254000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr4:253789-254038 (Activity detected in: mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-254 has unique ID: ARS410

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTATAGTTTTGCT                   
  Eaton et al. (2010):      TTTTTTATAGTTTTGCTTTGAATCTTTGTGTTT   
ACS LOGO:   ACS_logo  

ARS at IV-254 has unique ID: ARS410

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeAGCTGATGAAAAATTCTGTC
S. kudriavzeviiAATTGGTGAAAAATTTTGTC
S. mikataeAATTGATGGAATATTCTGTC
S. paradoxusAGCTGGTAGAAAATTCTGTC
S. bayanusAATTGGTGAAAAATTCTATC
****:**:***:*:**

ARS at IV-254 has unique ID: ARS410

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-254 has unique ID: ARS410

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at IV-254 has unique ID: ARS410