Confirmed ARS at IV-213

ARS409

Other names: proARS409

Status: Confirmed ARS: Confirmed by ARS assay and identified by 10 genome-wide studies.

Genomic Location: Chr4:212420-212669
Within divergent intergenic space between YDL139C and YDL138W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -138.9 ΔG° (kcal/mol) at location 212640.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 36.0 min.
Yabuki et al. (2002) — Trep: 25.2 min.
Alvino et al. (2007) — Peak first observed at 15.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at IV-213 has unique ID: ARS409

Loading - Please wait...

ARS at IV-213 has unique ID: ARS409

Studies that cloned this origin

Nieduszynski et al. (2006): Chr4:212420-212669


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr4:212119-213352

Xu et al. (2006): Chr4:211355-213505

Shor et al. (2009): Chr4:212100-213100 (orc2-1/wt peak ratio: 1.10)

Szilard et al. (2010): Chr4:212455-212465

Müller et al. (2010): Chr4:211850-213350 (orc1-bah-delta/wt peak ratio: 0.75)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr4:209804 (Trep: 36.0 min.) (Confidence: 5)

Yabuki et al. (2002): Chr4:210791 (Trep: 25.2 min.)

Alvino et al. (2007): Chr4:214670 (Peak first observed at 15.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr4:212000 (Activity detected in: rad53)

Crabbé et al. (2010): Chr4:212420-212669 (Activity detected in: rad9, rev3 rad30, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at IV-213 has unique ID: ARS409

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTTATATTTTGTT                   
  Xu et al. (2006):      TTTTTTTATATTTTGTTGTTGGTTTCAGGAAAAA  
  Xu et al. (2006):      TTTTTTTATTTTTTTTTGCAAAGCTCCCTTTTTC  
  Eaton et al. (2010):      TTTTTTTATATTTTGTTGTTGGTTTCAGGAAAA   
ACS LOGO:   ACS_logo  

ARS at IV-213 has unique ID: ARS409

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeAAAATCCTGCTTATCATTTTTTTTTTATATTTTGTTGTTGGTTTCAGGAAAAAGGG
S. kudriavzeviiTTACTCC--GATCGGTTTTTGTTTTTATATTTTGTTTCTTCATCTAAG--------
S. mikatae----TCCTGGTTCTTTCTCTTTTATTATATTTTGTTGTAAATTTCATAAAAACTAA
S. paradoxusAAAAACCT---------TCTTTTTTTATATTTTGTTATTATTCTTGAG-AAGCTGG
S. bayanusGCATTCCTGGTTCAGATTTTCATTTT---TTTAGTT--------------------
::**:::::**:*:**:::***:***:::::

ARS at IV-213 has unique ID: ARS409

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at IV-213 has unique ID: ARS409

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at IV-213 has unique ID: ARS409