Confirmed ARS at III-225

ARS315

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 9 genome-wide studies.

Genomic Location: Chr3:224807-225053
Within tandem intergenic space between YCR060W and YCR061W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -144.6 ΔG° (kcal/mol) at location 224867.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 14.8 min.
Yabuki et al. (2002) — Trep: 24.2 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-225 has unique ID: ARS315

Loading - Please wait...

ARS at III-225 has unique ID: ARS315

Studies that cloned this origin

Poloumienko et al. (2001): Chr3:224796-225360

Nieduszynski et al. (2006): Chr3:224807-225053


Studies that analyzed this origin by 2D gel

Poloumienko et al. (2001): Chr3:222368-226808

Tourrière et al. (2005): Chr3:222374-226803


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr3:223725-225575

Shor et al. (2009): Chr3:224300-225300 (orc2-1/wt peak ratio: 0.66)

Szilard et al. (2010): Chr3:224975-224985

Müller et al. (2010): Chr3:224300-225125 (orc1-bah-delta/wt peak ratio: 0.76)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:227557 (Trep: 14.8 min.) (Confidence: 9)

Yabuki et al. (2002): Chr3:222863 (Trep: 24.2 min.)

Alvino et al. (2007): Chr3:221330 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:224666 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr3:224807-225053 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-225 has unique ID: ARS315

Studies that confirmed an essential ACS element

  Crampton et al. (2008):         TTTTATGTTTTT                     

Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTTATGTTTTTCT                   
  Xu et al. (2006):      TTTTATGTTTTTCTTCGCGCGTCAACTTTCTACC  
ACS LOGO:   ACS_logo  

ARS at III-225 has unique ID: ARS315

Alignments from the UCSC genome browser

Predicted ACS
*

ARS at III-225 has unique ID: ARS315

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-225 has unique ID: ARS315

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Poloumienko et al. (2001): PubMed | PubMed Central

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Poloumienko et al. (2001): PubMed | PubMed Central

Tourrière et al. (2005): PubMed | Mol. Cell


Studies that confirmed an essential ACS element

Crampton et al. (2008): PubMed | Mol. Cell


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at III-225 has unique ID: ARS315