Confirmed ARS at III-167

ARS310

Other names: proARS310

Status: Confirmed ARS: Confirmed by ARS assay and identified by 9 genome-wide studies.

Genomic Location: Chr3:166494-167340
Within tandem intergenic space between YCR026C and YCR027C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -146.1 ΔG° (kcal/mol) at location 166804.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 24.9 min.
Yabuki et al. (2002) — Trep: 24.1 min.
Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at III-167 has unique ID: ARS310

Loading - Please wait...

ARS at III-167 has unique ID: ARS310

Studies that cloned this origin

Newlon et al. (1991): Chr3:166494-167340


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr3:166050-167084

Xu et al. (2006): Chr3:165855-167585

Szilard et al. (2010): Chr3:166745-166755

Müller et al. (2010): Chr3:166475-167075 (orc1-bah-delta/wt peak ratio: 0.64)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr3:174486 (Trep: 24.9 min.) (Confidence: 9)

Yabuki et al. (2002): Chr3:162863 (Trep: 24.1 min.)

Alvino et al. (2007): Chr3:163220 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr3:166666 (Activity detected in: wild-type, rad53)

Crabbé et al. (2010): Chr3:166494-167340 (Activity detected in: wild-type, rad9, rev3 rad30, eco1, ctf4, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at III-167 has unique ID: ARS310

Studies that confirmed an essential ACS element

  Theis & Newlon (2001):         TTTTTACTTTTT                     

Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       ATTATTTATGTTATGT                   
  Xu et al. (2006):      TTAATTATTTACATTTACGAATAAATTTGTATAT  
  Xu et al. (2006):      TAAAAATTTCATGTTTAGAATGCTCCTACATGTG  
  Xu et al. (2006):      CTTTTTTTTTACTTTTTGCTCTAAGAGTTACGAT  
  Xu et al. (2006):      ATTTATGTTATGTATATATAATCGTAACTCTTAG  
ACS LOGO:   ACS_logo  

ARS at III-167 has unique ID: ARS310

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTCCAGGTGATGTTTTATTCCATTATTTATGTTATGTATATATAATCGTAACTCTTA
S. kudriavzeviiCCTCAATGATTTTTTT-TCTGTTATTTACGTTGTGTAGGTAGGGTC-TGTCTTTTG
S. mikataeTCCAGACAGTCCCTCA-TCTATTATTTACGTTGTGTTTGCAAAACGGTACATCT--
S. paradoxusTCATGGTGATATTTTATTGTATTATTTATGTTATGTATTTGCAATCGTACTTCTTG
S. bayanusTCCTGATGATTTTTTTTTTAATTGTTAATGTTTTGTGTTTAAAAGCCT--CTATTG
:*::::*:::*:*::**:**:*******::::::::*:**::

ARS at III-167 has unique ID: ARS310

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at III-167 has unique ID: ARS310

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Newlon et al. (1991): PubMed | PubMed Central


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Theis & Newlon (2001): PubMed | PubMed Central | Mol. Cell. Biol.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at III-167 has unique ID: ARS310