Confirmed ARS at XII-1007

ARS1232

Other names: proARS1232

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr12:1007180-1007470
Within convergent intergenic space between YLR435W and YLR436C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -134.4 ΔG° (kcal/mol) at location 1007180.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 27.8 min.
Yabuki et al. (2002) — Trep: 27.1 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XII-1007 has unique ID: ARS1232

Loading - Please wait...

ARS at XII-1007 has unique ID: ARS1232

Studies that cloned this origin

Nieduszynski et al. (2006): Chr12:1007180-1007470


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr12:1006989-1007415

Szilard et al. (2010): Chr12:1007265-1007275

Müller et al. (2010): Chr12:1007075-1007525 (orc1-bah-delta/wt peak ratio: 0.46)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr12:1006700 (Trep: 27.8 min.) (Confidence: 9)

Yabuki et al. (2002): Chr12:1006804 (Trep: 27.1 min.)

Alvino et al. (2007): Chr12:1008100 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr12:1006666 (Activity detected in: rad53)

Crabbé et al. (2010): Chr12:1007180-1007470 (Activity detected in: wild-type, rev3 rad30, eco1, ddc1, rad24, pol2-12, elg1, tof1, mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XII-1007 has unique ID: ARS1232

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TATTTTTATATTTTGT                   
ACS LOGO:   ACS_logo  

ARS at XII-1007 has unique ID: ARS1232

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTGTGTATTTTTTATGTTTCATATTTTTATATTTTGTGTTTGCTAAGGTCTAATCGT
S. kudriavzeviiGAGATGAATTACGTATTCCCCAATTTTGTATTTG----------------------
S. mikataeT---CATGCTTCATCCGGAATATTTTTATGTTTTCTTATAACTGGGGAAAATTTGT
S. paradoxusGAAATGATCTTTATGCTTGATATTTTTATATTTTGTAATTATAGAGGACTACTTGT
S. bayanusTATATAATTTTTGTCATGATTCACTTTACATACTGGACGAG------TAAAACTGT
:::*:*::::***:::*::::::::::

ARS at XII-1007 has unique ID: ARS1232

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XII-1007 has unique ID: ARS1232

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


ARS at XII-1007 has unique ID: ARS1232