Confirmed ARS at XII-289

ARS1212

Other names: proARS1212

Status: Confirmed ARS: Confirmed by ARS assay and 2D gel and identified by 10 genome-wide studies.

Genomic Location: Chr12:289220-289469
Within tandem intergenic space between YLR080W and YLR081W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -152.0 ΔG° (kcal/mol) at location 289450.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 33.4 min.
Yabuki et al. (2002) — Trep: 31.5 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XII-289 has unique ID: ARS1212

Loading - Please wait...

ARS at XII-289 has unique ID: ARS1212

Studies that cloned this origin

Nieduszynski et al. (2006): Chr12:289220-289469


Studies that analyzed this origin by 2D gel

Aparicio et al. (2004): Chr12:286400-292326

Tourrière et al. (2005): Chr12:286400-292326

Crabbé et al. (2010): Chr12:286400-292326


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr12:289251-290213

Xu et al. (2006): Chr12:287935-290625

Shor et al. (2009): Chr12:288900-290800 (orc2-1/wt peak ratio: 0.64)

Szilard et al. (2010): Chr12:289465-289475

Müller et al. (2010): Chr12:288725-290075 (orc1-bah-delta/wt peak ratio: 0.51)


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr12:292379 (Trep: 33.4 min.) (Confidence: 9)

Yabuki et al. (2002): Chr12:293804 (Trep: 31.5 min.)

Alvino et al. (2007): Chr12:294130 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr12:289333 (Activity detected in: rad53)

Crabbé et al. (2010): Chr12:289220-289469 (Activity detected in: mrc1-AQ rad9, ctf8, ctf18, mrc1, dcc1, ctf18 rad9, mec1-100, rad53, mec1)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XII-289 has unique ID: ARS1212

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       AAATTAATGTTTTGCT                   
  Eaton et al. (2010):      AAAATTAATGTTTTGCTGCTTTTACTGTCGCGT   
ACS LOGO:   ACS_logo  

ARS at XII-289 has unique ID: ARS1212

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeTTACTGTCGTCTTGGAAGCAAAATTAATGTTTTGCTGCTTTTACTGTCGCGTTTAA
S. paradoxusTTACTGCAAACTTGGAAGCAAAATTTATATTTTGTTGCTTTTACCGTTGCGCCTTG
S. bayanusTCGCTGTAAATATGAAAAAAAAATTTATATTTTGTTACTATTGC-ATCGCGTTTTG
*::***:::**:**::**************:**:**:*:*:***::*

ARS at XII-289 has unique ID: ARS1212

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XII-289 has unique ID: ARS1212

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

Aparicio et al. (2004): PubMed | PubMed Central | Mol. Cell. Biol.

Tourrière et al. (2005): PubMed | Mol. Cell

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XII-289 has unique ID: ARS1212