Confirmed ARS at XII-451

ARS1216

Other names: proARS1216

Status: Confirmed ARS: Confirmed by ARS assay and identified by 8 genome-wide studies.

Genomic Location: Chr12:450485-450726
Within divergent intergenic space between TQ(UUG)L and YLR154W-C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -140.7 ΔG° (kcal/mol) at location 450485.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 24.8 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XII-451 has unique ID: 416

Loading - Please wait...

ARS at XII-451 has unique ID: 416

Studies that cloned this origin

Nieduszynski et al. (2006): Chr12:450485-450726


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr12:449029-450404

Xu et al. (2006): Chr12:449475-451615

Shor et al. (2009): Chr12:449900-469200 (orc2-1/wt peak ratio: 0.67)

Szilard et al. (2010): Chr12:450595-450605

Müller et al. (2010): Chr12:449825-451400 (orc1-bah-delta/wt peak ratio: 0.53)


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr12:448304 (Trep: 24.8 min.)

Alvino et al. (2007): Chr12:450290 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Feng et al. (2006): Chr12:449500 (Activity detected in: rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XII-451 has unique ID: 416

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Nieduszynski et al. (2006):       TTTTTTATATCTTGCT                   
  Xu et al. (2006):      TTTTTTTATATCTTGCTTATAAAGCAGAAGGTGA  
  Xu et al. (2006):      CGTTTTTATGTTTATTCGCTAAAACCCTTCTTAT  
  Eaton et al. (2010):      CGTTTTTATGTTTATTCGCTAAAACCCTTCTTA   
ACS LOGO:   ACS_logo  

ARS at XII-451 has unique ID: 416

Alignments from the UCSC genome browser

Predicted ACS
S. cerevisiaeGAATCAATCGATCCATATTTTTTTTTATATCTTGCTTATAAAGCAGAAGGTGATTT
S. paradoxusGAACCATTCGGCGTGCG---CTTTATATACCACTACTATATGATATAAGAAGATCA
***:**:***:::::::::::***:****:*:::::****::::*:***::***::

ARS at XII-451 has unique ID: 416

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XII-451 has unique ID: 416

Genome-wide studies that identified this origin

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Feng et al. (2006): PubMed | PubMed Central | Nat. Cell Biol.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.

Müller et al. (2010): PubMed | PubMed Central | Genes Dev.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XII-451 has unique ID: 416