Confirmed ARS at VII-569

ARS721

Other names: proARS721

Status: Confirmed ARS: Confirmed by ARS assay and identified by 6 genome-wide studies.

Genomic Location: Chr7:568490-568738
Within divergent intergenic space between TS(AGA)G and YGR040W.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS confirmed.

Helical Stability: Minimum -145.7 ΔG° (kcal/mol) at location 568550.

Time of Origin Replication (Trep): Raghuraman et al. (2001) — Trep: 29.6 min.
Yabuki et al. (2002) — Trep: 21.1 min.
Alvino et al. (2007) — Peak first observed at 12.5 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at VII-569 has unique ID: 238

Loading - Please wait...

ARS at VII-569 has unique ID: 238

Studies that cloned this origin

Nieduszynski et al. (2006): Chr7:568490-568738


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Wyrick et al. (2001): Chr7:567754-568734

Xu et al. (2006): Chr7:567845-568755

Szilard et al. (2010): Chr7:568705-568715


Studies that measured the replication time of this origin

Raghuraman et al. (2001): Chr7:560991 (Trep: 29.6 min.) (Confidence: 9)

Yabuki et al. (2002): Chr7:570897 (Trep: 21.1 min.)

Alvino et al. (2007): Chr7:575250 (Peak first observed at 12.5 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at VII-569 has unique ID: 238

Studies that confirmed an essential ACS element

  Nieduszynski et al. (2006):       AGTATTTATATTTAGC                   

Studies that predicted an essential ACS element

  Xu et al. (2006):      ATCAGTATTTATATTTAGCCCCTCCTCAGTCTTT  
ACS LOGO:   ACS_logo  

ARS at VII-569 has unique ID: 238

Alignments from the UCSC genome browser

Confirmed ACS
S. cerevisiae--------------------AGTATTTATATTTAGCCCCTCCTCAGTCTTTTGTTT
S. kudriavzevii--------------------AGTTTTTTTTTTTA----------AGTATTTTTTCT
S. mikatae--------------------TATGTTGATAATTAG---------------------
S. paradoxus--------------------------TAAATTTAGCCCTTCTTCAGTTGTTTCTT-
S. bayanus--------------------ATTATT------------------------------
::::::::::

ARS at VII-569 has unique ID: 238

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at VII-569 has unique ID: 238

Genome-wide studies that identified this origin

Raghuraman et al. (2001): PubMed | Science

Wyrick et al. (2001): PubMed | Science

Yabuki et al. (2002): PubMed

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Szilard et al. (2010): PubMed | PubMed Central | Nat. Struct. Mol. Biol.


Studies that cloned this origin

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

Nieduszynski et al. (2006): PubMed | PubMed Central | Genes Dev.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at VII-569 has unique ID: 238