Dubious ARS at XV-1072

No systematic name assigned

Status: Dubious ARS: Identified by 2 genome-wide studies.

Genomic Location: Chr15:1071098-1072802
Probably within tandem intergenic space between YOR387C and YOR388C.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -163.5 ΔG° (kcal/mol) at location 1072608.

Time of Origin Replication (Trep): Yabuki et al. (2002) — Trep: 26.7 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at XV-1072 has unique ID: 760

Loading - Please wait...

ARS at XV-1072 has unique ID: 760

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr15:1071100-1072800


Studies that measured the replication time of this origin

Yabuki et al. (2002): Chr15:1075721 (Trep: 26.7 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XV-1072 has unique ID: 760

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      CTTTTGTTCTTGTTTTGGCGTATTCTCCACTATT  
ACS LOGO:   ACS_logo  

ARS at XV-1072 has unique ID: 760

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XV-1072 has unique ID: 760

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XV-1072 has unique ID: 760

Genome-wide studies that identified this origin

Yabuki et al. (2002): PubMed

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XV-1072 has unique ID: 760