Dubious ARS at XV-160

No systematic name assigned

Status: Dubious ARS: Identified by 3 genome-wide studies.

Genomic Location: Chr15:159203-160567
Probably within convergent intergenic space between YOL086W-A and YOL086C.
View at UCSC genome browser
View on SGD Chromosome Features Map
View at SGD gbrowser site
View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -168.5 ΔG° (kcal/mol) at location 160353.

Time of Origin Replication (Trep): Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity not detected in HU.

ARS at XV-160 has unique ID: 746

Loading - Please wait...

ARS at XV-160 has unique ID: 746

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr15:159205-160565

Shor et al. (2009): Chr15:159400-160600 (orc2-1/wt peak ratio: 1.29)


Studies that measured the replication time of this origin

Alvino et al. (2007): Chr15:167000 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

This origin has not be reported as active in HU by any curated study.


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XV-160 has unique ID: 746

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Eaton et al. (2010):      ATGATTTATGATTTTTATTATTAAATAAGTTAT   
ACS LOGO:   ACS_logo  

ARS at XV-160 has unique ID: 746

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XV-160 has unique ID: 746

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XV-160 has unique ID: 746

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Shor et al. (2009): PubMed | PubMed Central | PLoS Genet.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Eaton et al. (2010): PubMed | PubMed Central | Genes Dev.


ARS at XV-160 has unique ID: 746