Likely ARS at XIII-569

No systematic name assigned

Status: Likely ARS: Identified by 3 genome-wide studies.

Genomic Location: Chr13:568128-569097
Probably within divergent intergenic space between YMR154C and YMR155W.
• View at UCSC genome browser
• View on SGD Chromosome Features Map
• View at SGD gbrowser site
• View at Ensembl browser

DNA Sequence:

Origin Sequence Elements: ACS predicted.

Helical Stability: Minimum -154.9 ΔG° (kcal/mol) at location 568978.

Time of Origin Replication (Trep): Alvino et al. (2007) — Peak first observed at 10.0 min.

Origin activity in HU: Origin activity detected in HU — more details.

ARS at XIII-569 has unique ID: 739

Loading - Please wait...

ARS at XIII-569 has unique ID: 739

Studies that cloned this origin

None curated.


Studies that analyzed this origin by 2D gel

None curated.


Studies that detected this origin by chromatin immunoprecipitation (ChIP)

Xu et al. (2006): Chr13:568130-569095


Studies that measured the replication time of this origin

Alvino et al. (2007): Chr13:572330 (Peak first observed at 10.0 min.)


Studies that measured the activity of this origin in hydroxyurea (HU)

Crabbé et al. (2010): Chr13:568198-568698 (Activity detected in: mrc1-AQ, mrc1-AQ rad9, ctf8, ctf18, mrc1, rad53)


Studies that predicted the location of this origin

This origin has not been predicted by any curated study.



ARS at XIII-569 has unique ID: 739

Studies that confirmed an essential ACS element

None curated.


Studies that predicted an essential ACS element

  Xu et al. (2006):      AGTATATATGTTTTCTTTAAAATTTCAGAGCATA  
ACS LOGO:   ACS_logo  

ARS at XIII-569 has unique ID: 739

Alignments from the UCSC genome browser

No phylogenetic sequence conservation data.

ARS at XIII-569 has unique ID: 739

These notes are manually curated. To submit notes for this replication origin site please contact us.

There are no notes entered for this replication origin site.

ARS at XIII-569 has unique ID: 739

Genome-wide studies that identified this origin

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics

Alvino et al. (2007): PubMed | PubMed Central | Mol. Cell. Biol.

Crabbé et al. (2010): PubMed | Nat. Struct. Mol. Biol.


Studies that cloned this origin

None identified.


Studies that analyzed this origin by 2D gel

None identified.


Studies that confirmed an essential ACS element

None identified.


Studies that predicted an essential ACS element

Xu et al. (2006): PubMed | PubMed Central | BMC Genomics


ARS at XIII-569 has unique ID: 739